ncbi-mcp-server

hamzameer/ncbi-mcp-server

3.2

If you are the rightful owner of ncbi-mcp-server and would like to certify it and/or have it hosted online, please leave a comment on the right or send an email to dayong@mcphub.com.

The NCBI MCP Server is a Model Context Protocol server that provides access to NCBI E-utilities and BLAST tools, enabling AI applications to intelligently search, fetch, and analyze biological data from NCBI databases.

Tools
7
Resources
0
Prompts
0

NCBI MCP Server

A Model Context Protocol (MCP) server that provides access to NCBI E-utilities and BLAST tools. This server enables AI applications like Claude Desktop to search, fetch, and analyze biological data from NCBI databases in an intelligent, agentic manner.

Features

🔧 Tools Available

  • search_ncbi - Search any NCBI database with natural language queries
  • fetch_records - Retrieve full records in various formats (XML, FASTA, GenBank, etc.)
  • summarize_records - Get structured summaries with titles, authors, journals, etc.
  • find_related_records - Discover related records across different databases
  • blast_search - Perform BLAST sequence alignment searches
  • list_databases - Get all available NCBI databases
  • get_database_info - Get detailed information about specific databases

📚 Resources Available

  • ncbi://databases - Comprehensive list of NCBI databases with descriptions
  • ncbi://blast-programs - Guide to BLAST programs and databases

🧠 Agentic Behavior Examples

When you ask Claude Desktop questions, it will intelligently use multiple tools together:

Example Query: "Find recent papers about CRISPR gene editing in humans and get me the abstracts"

Claude will automatically:

  1. Use search_ncbi to search PubMed for CRISPR papers
  2. Use summarize_records to get abstracts and metadata
  3. Present the information in a readable format

Example Query: "I have this DNA sequence ATCGATCGATCG - what protein does it code for?"

Claude will automatically:

  1. Use blast_search with blastx program to translate and search against protein databases
  2. Analyze the results to identify the most likely protein matches
  3. Possibly use fetch_records to get more details about matches

Example Query: "Show me all the genome assemblies for E. coli and their quality metrics"

Claude will automatically:

  1. Use search_ncbi on the assembly database for E. coli
  2. Use fetch_records to get detailed assembly information
  3. Parse and present the quality metrics in a structured way

Quick Start

Installation

Install using uv (recommended):

uv add ncbi-mcp-server

Or with pip:

pip install -e .

Configuration

  1. Get an NCBI API Key (Recommended)

  2. Set Environment Variables

    cp env.example .env
    # Edit .env with your credentials
    export NCBI_API_KEY="your_api_key_here"
    export NCBI_EMAIL="your.email@example.com"
    

Usage with Claude Desktop

  1. Install in Claude Desktop:

    mcp install ncbi_mcp_server/server.py --name "NCBI Research Assistant"
    
  2. Or add to Claude config manually:

    {
      "mcpServers": {
        "ncbi": {
          "command": "python",
          "args": ["/path/to/ncbi_mcp_server/server.py"],
          "env": {
            "NCBI_API_KEY": "your_api_key",
            "NCBI_EMAIL": "your.email@example.com"
          }
        }
      }
    }
    
  3. Start using it! Ask Claude questions like:

    • "Find the latest research on Alzheimer's disease genetics"
    • "BLAST this protein sequence and tell me what it is"
    • "Get me information about the human genome assembly"
    • "Find papers by author John Smith about cancer research"

Development & Testing

Test your server with the MCP Inspector:

mcp dev ncbi_mcp_server/server.py

Run with custom environment:

NCBI_API_KEY=your_key mcp dev ncbi_mcp_server/server.py

Supported NCBI Databases

The server works with all NCBI databases including:

Literature & References

  • pubmed - PubMed biomedical literature
  • pmc - PubMed Central full-text articles
  • books - NCBI Bookshelf

Sequences

  • nucleotide - Nucleotide sequences
  • protein - Protein sequences
  • nuccore - Nucleotide collection (GenBank+EMBL+DDBJ+PDB+RefSeq)

Genomes & Assemblies

  • genome - Genome sequencing projects
  • assembly - Genome assemblies
  • gene - Gene-centered information

Specialized Databases

  • sra - Sequence Read Archive
  • taxonomy - Taxonomic information
  • snp - Single Nucleotide Polymorphisms
  • clinvar - Clinical significance of genomic variation
  • mesh - Medical Subject Headings

BLAST Programs Supported

  • blastn - Nucleotide vs nucleotide
  • blastp - Protein vs protein
  • blastx - Translated nucleotide vs protein
  • tblastn - Protein vs translated nucleotide
  • tblastx - Translated nucleotide vs translated nucleotide

Example Workflows

Literature Research

User: "Find recent papers about COVID-19 vaccines effectiveness"
→ Claude automatically searches PubMed
→ Gets paper summaries with abstracts  
→ Presents organized results with key findings

Sequence Analysis

User: "Analyze this DNA sequence: ATCGATCGATCGAAATTTCCCGGG"
→ Claude runs appropriate BLAST search
→ Identifies similar sequences and organisms
→ Explains biological significance

Comparative Genomics

User: "Compare the genome assemblies of different E. coli strains"  
→ Claude searches assembly database
→ Fetches assembly statistics
→ Compares quality metrics and completeness

Rate Limits & Best Practices

  • With API Key: 10 requests/second
  • Without API Key: 3 requests/second
  • Always provide email: Required by NCBI terms of service
  • Be respectful: Don't overwhelm NCBI servers

Troubleshooting

Common Issues

  1. Rate Limiting Errors

    • Get an NCBI API key for higher limits
    • Reduce request frequency
  2. No Results Found

    • Check database name spelling
    • Try broader search terms
    • Verify sequence format for BLAST
  3. Connection Errors

    • Check internet connectivity
    • Verify NCBI services are operational

Debug Mode

Run with verbose logging:

DEBUG=1 mcp dev ncbi_mcp_server/server.py

Contributing

Contributions welcome! Please see the development setup:

git clone https://github.com/your-username/ncbi-mcp-server.git
cd ncbi-mcp-server
uv sync
uv run mcp dev ncbi_mcp_server/server.py

License

MIT License - see LICENSE file for details.

Acknowledgments